Not very nice logo, but the first author insisted on it. The last author thinks it could be much better. Or the pure text instead.

RNAProbe - a web server for normalization and analysis of RNA structure probing data. You can take a (quick) NAP, while we analyze your data :)

Frequently Asked Questions (and Answers)


What is the SHAPE experiment?

SHAPE (selective 2’-hydroxyl acylation analyzed by primer extension) experiment [1] [2] is a chemical probing experiment allowing to study flexible parts of RNA backbone. The results of the experiment can be later used to predict RNAs secondary structure more accurately. Read more about RNA chemical probing.


What is QuShape?

QuShape is a software for analysis of the electrophoresis-detected nucleic acid chemical probing experiments. You can read more about QuShape in the publication [3]


Why do I need to normalize the output of the QuShape program?

The reactivities after QuShape analysis are pre-normalized, however, in order to compare results from different experiments, they should be further normalized. Normalization includes discarding outlier reactivity values and setting the reactivity range to 0 to 1.


What is the benefit of using this server?

The benefit of using this server is mainly in time reduction and removing human-induced errors during normalization, prediction, and visualization of the results. The whole procedure takes a few minutes instead of: ~20-30 min of manual normalization, ~10-15 min of predictions using various methods, ~10-ifinity min of visualizing results. Here, everything is being done by few simple clicks, and the user gets a comprehensive set of results, with publication-quality visualizations, being sure that for all analyses, the whole process will be exactly the same.


What is the SHAPE cassette?

If you are here, you should probably know this already, right? :) SHAPE cassette is a special nucleotide sequence added at the 5’ and 3’ ends of the studied RNA. The added sequences are needed to facilitate analysis of all nucleotides within the molecules’ area of interest, and should not affect the structure of the studied molecule [2].


What is the sequence file?

The sequence file is a text file containing the sequence of RNA. The format of the file is as follows:

GGGCCUUCGGGCCAACGCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUGAAGUGUCGAUCCGGU ...
See the sample sequence file

What is the QuSHAPe results file?

The QuShape results file is a text file (tab-delimited) generated as a result of the QuShape analysis. The format of the file is as follows:

    seqNum      seqRNA  posSeq  posRX   areaRX  posBG   areaBG  areaDiff        normDiff
    7   U       956     944     11258.34        944     9638.54 1619.8  0.12
    8   C       946     939     5221.6  938     5096.91 124.7   0.01
    9   G       938     930     30072.11        930     5597.38 24474.72        1.76
    10  G       931     920     14700.55        920     8996.24 5704.31 0.41
    11  G       922     906     82235.32        906     95511.97        -13276.65       0.0
    ...
See the sample QuShape analysis file

What is the reactivities file?

The reactivities file is a text file with two columns, with a nucleotide number and its corresponding reactivity value. The format of the file is the same as used in the SHAPE directed predictions with RNAfold and ShapeKnots. The format of the file is as follows:

    1 0.03
    2 1.0
    3 1.0
    4 1.0
    5 1.0
    6 0.06
    7 0.2
    8 0.25
    ...
See the sample reactivities file

What file extensions are allowed?

Currently we are supporting the files with the following extensions:

'txt', 'csv', 'tab', 'tsv', 'fasta', 'fa', 'seq'

How to paste the RNA sequence?

Currently we are supporting RNA sequence in either pure-sequence format:

GGGCCUUCGGGCCAACGCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUGAAGUGUCGAUCCGGUUCGCCGGAUCCAAAUCGGGCUUCGGUCCGGUUC

or in fasta format:


>Adenine riboswitch
GGGCCUUCGGGCCAACGCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAG
AGCCUUAAACUCUUGAUUAUGAAGUGUCGAUCCGGUUCGCCGGAUCCAAAUCGGGCUUCG
GUCCGGUUC

How to impose the secondary structure?

Information on the secondary structure is optional an can be used to map reactivities to a given structure (without prediction). The server uses the secondary structure information in a dot-bracket format, e.g:

((((((((...((((((.........))))))........((((((.......))))))..)))))))).

Can I map the reactivities to 3D structure?

Yes, you can! Just upload your PDB when starting the job, and you will have a beautifull structure with mapped reactivities after the job is done!


How can I get access to the results of the analysis?

At the moment of submission of your analysis, you will be prompted with the link to the results page. You may bookmark the page and check your results later. The results are being kept on the server for seven days.


Can I download the results?

Yes. On the results page, you can view your results and download them either one by one, clicking on the links under the image/table:

or in a single zip archive, by clicking:

Look at this tutorial to learn how to extract files from the zip archive in Windows. To extract files under Linux, use the command line and run the command:

unzip results.zip


How many jobs can I submit?

There are no limitations for submitting jobs. The only limitation is the server disk space, so please be considerate and do not upload 10000 results at once :)

If you want to process a bigger bunch of data, please contact us, we will try to establish a convenient pipeline/collaboration for processing the data.


Can I use my custom normalization scheme?

Yes. You can use your custom normalized reactivities in the SHAPE Custom Mode. You need to provide a sequence file and reactivities file in a proper format.


Can I predict structure from sequence only?

Yes. You can use this server as a secondary structure predictor. You have to use Predict Mode and provide a sequence file. You will get results from several prediction methods.


Can I normalize and visualize results from replications of an experiment?

Yes. You can calculate the average of several replications of an experiment, by using SHAPE Mode and uploading multiple QuShape files. You will get results for the averaged reactivities over multiple experiments.


What is SimRNAweb?

SimRNAweb is a server for RNA 3D structure prediction (and it is one of the best available!). You can predict the structure using only sequence, or by utilizing additional folding restraints. All analyses from RNAProbe, provide you with a link to SimRNAweb, where almost everything is filled for you, you just have to hit the 'submit' buitton.


How long does the analysis take?

The analysis itself usually takes up to two minutes; however, depending on the server load, it may take more time if there are many jobs in the queue.


What is the quality of the generated images?

The images generated by the server are of very high quality. The resolution is usually ~10 megapixels or more. They are definitively publication quality.


Can I analyze only a part of the sequence?

Yes. You can specify the region of analysis by changing the values of nucleotides to be omitted on the 5’ and 3’ ends.


Are there any customization options?

Yes. There are multiple color choices for generated reactivity heatmaps. Check by yourself, and find your favorite :)


Can I download this software and use it locally?

No. The server is aimed to be web-based service. As for now, there is no possibility to download the software and run it locally.


How to cite?

… In preparation


References