Tutorial

---

How to use:

The RNAProbe server has four main modes of analysis:

SHAPE Mode

analysis of SHAPE reactivities with the standard normalization protocol or using user-provided normalized reactivities.

DMS Mode

analysis of DMS reactivities with the standard normalization protocol or using user-provided normalized reactivities.

CMCT Mode

analysis of CMCT reactivities with the standard normalization protocol or using user-provided normalized reactivities.

Prediction Mode

prediction of RNA secondary structure by various predictors; the consensus of predictions is visualized.

---

1. SHAPE Mode

---

2. DMS / CMCT Mode

---

3. Prediction Mode

---

Description of inputs:

1. Sequence

The sequence file is a text file containing the sequence of RNA, ideally, the same file as used in the QuShape analysis. The sequence can also be pasted directly. The format of the file is as follows:

sequence.txt ( see the sample sequence file)

GGGCCUUCGGGCCAACGCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUGAAGUGUCGAUCCGGUUCGCCGGAUCCAAAUCGGGCUUCGGUCCGGUUC

The sequence may also be in the FASTA format.

2. QuShape results file

The QuShape results file is a text file (tab-delimited) generated as a result of the QuShape analysis. The format of the file is as follows:

QuShape.txt ( see the sample QuShape analysis file)

seqNum      seqRNA  posSeq  posRX   areaRX  posBG   areaBG  areaDiff        normDiff
7   U       956     944     11258.34        944     9638.54 1619.8  0.12
8   C       946     939     5221.6  938     5096.91 124.7   0.01
9   G       938     930     30072.11        930     5597.38 24474.72        1.76
10  G       931     920     14700.55        920     8996.24 5704.31 0.41
11  G       922     906     82235.32        906     95511.97        -13276.65       0.0
...

3. Reactivities file

The reactivities file is a text file with two columns, with a nucleotide number and its corresponding reactivity value. The format of the file is the same as used in the SHAPE directed predictions with RNAfold and ShapeKnots. The format of the file is as follows:

reactivities.txt ( see the sample reactivities file)

1 0.03
2 1.0
3 1.0
4 1.0
5 1.0
6 0.06
7 0.2
8 0.25
...

4. Secondary Structure

The secondary structure file is a text file containing the secondary structure of RNA in the dot-bracket notation, provided by the user in order to map reactivities to the structure. The structure can also be pasted directly. The format of the file is as follows:

structure.txt ( see the sample secondary structure file)

................((((((((((...((((((.........))))))........((((((.......))))))..))))))))))..........................................

5. PDB file

Standard PDB file. It would be nice if the molecule in teh file had the same sequence as the analyzed RNA :). The server checks if both sequences agrees, so if you are up to some mischief, the consequences may be unpredictable :)

---

Description of outputs:

1. VARNA representations for SHAPE directed predictions

The predicted structures are represented using VARNA software [REF]. For each of the methods, the images with structures are as follows:

• SHAPE Mode

Three representations (using three different VARNA algorithms) for two types of predictions each: SHAPE directed RNAfold and SHAPE directed ShapeKnots. The colors of the nucleotides represent the reactivities values generated by the normalization protocol employed on the server.

Below are example structures for SHAPE directed RNAfold structures: (note that the secondary structures are exactly the same, only their representations are different):




• DMS / CMCT Mode

Three representations (using three different VARNA algorithms) for Probing directed Fold prediction. The colors of the nucleotides represent the reactivities values.

Below are example structures for DMS directed Fold structures (note that the secondary structures are exactly the same, only their representations are different):




• Prediction Mode

Three representations (using three different VARNA algorithms) for a structure being a consensus of all secondary structure predictions (generated by our in-house method).

Below are example structures for consensus structure (note that the secondary structures are exactly the same, only their representations are different):

2. XLSX/HTML table with all results

The table with all results are available in two forms: HTML viewed on the website, and XLSX for download. Both of the tables are identical. The table viewed on the website is scrollable. The table is divided into five main parts:

• Name - the name that user provided in the 'Name of the job:' box
• Method - lists the methods used to generate secondary structure
• Filenames - a combined name of the uploaded file, along with the analysis mode
• Full string - sequence/secondary structure, represented as a string, allowing the user to copy-paste it, depending on the needs.
• Sequence/reactivity/structure - in this part, information (the type of nucleotide, reactivity value, structure) for each nucleotide is placed in a separate cell. This feature is extremely useful in comparative analyses between experiments (e.g., repeats, controls, different RNA variants, etc.).

Below is an example result table:

3. Heatmap and barplot

The heatmap and barplot images are available for all three Probing modes.

• The heatmap plot represents the reactivity value for each nucleotide in a separate box. The heatmap plots may be useful in a comparison between experiments, and can be easily incorporated as an image for publication.



• The barplot represents the reactivity value for each nucleotide in a generally recognized format used in publications. The reactivities are colored as follows: 0.0 to 0.3 - black, 0.3 to 0.7 - orange, 0.7 to 1.0 - red. In this representation, the user can easily spot which nucleotides are highly-reactive/non-reactive.

4. Text files with predictions

The server generates a series of textfiles with results, providing interoperability with bioinformatic workflows.

• All predictions (txt file) ( see the sample all predictions file)

  The file consists of the name of the computation, sequence and predicted secondary structures for all utilized pediction methods. his file can be easily incorporated in bioinformatic pipelines, with simple fetching relevant information out of it. The format of the file is as follows:

>Adenine_Riboswitch_no_ligand_QuSHAPE_01.txt
GCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUGAAGUG
((((((((...((((((.........))))))((....))((((((.......))))))..)))))))). RNAfold with SHAPE data
((((((((...((((((.........))))))........((((((.......))))))..)))))))). ShapeKnots with SHAPE data

((((((((...((((((.........))))))........((((((.......))))))..)))))))). RNAfold
((((((((...(((((((......).))))))........((((((.......))))))..)))))))). RNAstructure ProbKnot
((((((((...((((((.........))))))........((((((.......))))))..)))))))). RNAstructure Fold
((((((((....(((((.........))))).........((((((.......))))))..)))))))). CentroidFold
((((((((..((((((((......).))))))((....))((((((.......)))))).))))))))). CONTRAfold
((((((((....(((((.........))))).........((((((.......))))))..)))))))). IPknot
((((((((...((((((.........))))))........((((((.......))))))..)))))))). LinearFold C
((((((((...((((((.........))))))........((((((.......))))))..)))))))). LinearFold V
((((((((...((((((.........))))))........((((((.......))))))..)))))))). Consensus from predictions thrs 0.5

• Reactivities (txt file) ( see the sample reactivities file)

  The reactivities file is a text file with two columns, with a nucleotide number and its corresponding reactivity value. The format of the file is the same as used in the SHAPE directed predictions with RNAfold and ShapeKnots. Note, that this file is not available in Predict Mode.The format of the file is as follows:

1 0.03
2 1.0
3 1.0
4 1.0
5 1.0
6 0.06
7 0.2
8 0.25
...

5. PDB file output

Standard PDB file, with modified B-factor according to the reactivity values. You can use it in any structure viewer that enables coloring by B-factor, and enjoy your mapped reactivities!

---